Glucokinase intrinsically regulates glucose sensing and glucagon secretion in pancreatic alpha cells

Glucokinase intrinsically regulates glucose sensing and glucagon secretion in pancreatic alpha cells

Isolation of islets of Langerhans from Wistar ratsThe study was performed in accordance with the NIH Guide for the Care and Use of Laboratory Animals and all procedures were approved by the Animal Ethics Committee of Northern Stockholm. Wistar rats (6–10 week-old) were obtained from Scanbur AB (Sollentuna, Sweden). Animals were housed at a constant room temperature (22 °C; 12 h light/dark cycle) with ad libitum access to food and water. The isolation of islets was performed as previously described16. Rats were anesthetized with isoflurane (Baxter, Kista, Sweden) before decapitation. Ice-cold isolation buffer (HBSS with 0.5% BSA, 100 units/ml penicillin G, 100 μg/ml streptomycin sulphate and 25 mM HEPES pH 7.4) containing 1 mg/ml collagenase A (Roche, Stockholm, Sweden) was injected into the pancreata. The pancreata were transferred to vials and digested at 37 °C. Then the tissue was washed with isolation buffer and islets were purified using a discontinuous Histopaque density gradient. The islets were washed and hand-picked into complete S-Minimum Essential Medium (S-MEM) (Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 10% FBS, 2 mM glutamine, 100 units/ml penicillin G, 100 μg/ml streptomycin sulphate and 25 mM HEPES.Separation of pancreatic alpha cells by flow cytometryAlpha cells were purified from dissociated islet cells using fluorescence-activated cell sorting (FACS) based on endogenous fluorescence and light scatter. We have previously established a one-step gating strategy that results in functional alpha cells with high purity (96.6 ± 1.4%)16. For each FACS preparation islets obtained from 3 to 4 rats were dispersed into single cells by incubation with Accutase (Innovative Cell Technologies, Cytotech, Hellebaek, Denmark). The cells were transferred to sorting buffer (HBSS containing 2.5 mM glucose, 1% BSA, 100 units/ml penicillin G, 100 μg/ml streptomycin sulphate and 25 mM HEPES pH 7.4) and sorted using an Influx cell sorter (BD Biosciences, San Jose, CA, USA) equipped with solid state lasers for 355 nm and 488 nm excitation and a 70 µm nozzle. Forward scatter with parallel polarization (FSC) and side scatter (SSC) were collected at 488 nm. FAD and NAD(P)H types of cellular autofluorescence were excited by 488 nm and 355 nm and collected after 528/38 and 460/50 band-pass filters, respectively. The purified alpha cells were cultured on poly-l-ornithine coated surfaces of either 96 well plates (3000 cells/well) or glass coverslips (~ 1000 cells/coverslip) in complete Improved MEM Zn2+ Option (Richter’s Modification) medium (Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 10% fetal bovine serum, 100 units/ml penicillin G, 100 μg/ml streptomycin sulphate and 10 mM HEPES pH 7.4. Cells were maintained at 37 °C in a humidified atmosphere with 5% CO2.Evaluation of glucagon secretion by static incubationSorted alpha cells cultured in 96-well plates (3000 cells/well) were washed twice with a buffer containing 0.1% BSA, 125 mM NaCl, 5.9 mM KCl, 1.28 mM CaCl2, 1.2 mM MgCl2, 5.5 mM glucose and 25 mM HEPES pH 7.4. Cells were incubated in the same buffer for 40 min at 37 °C. After removal, the buffer was replaced by buffer containing different concentrations of glucose, as specified in the results section. After 30 min incubation at 37 °C, the buffer was collected and centrifuged at 4 °C to remove cellular debris. The cells were lysed in the wells with M-PER Mammalian Protein Extraction Reagent (Thermo Scientific, VWR International AB, Stockholm, Sweden). The Glucagon RIA kit GL-32 K from Millipore (Solna, Sweden) was used for determining both the glucagon concentration in the buffer (secreted hormone) and the total cellular glucagon content. Data were analysed using the GraphPad Prism 5 (GraphPad Software Inc., San Diego, USA) with Student’s t test. Differences were considered statistically significant at p ≤ 0.05.Biosensor constructionSuper-ecliptic pHluorin spH35 was generated by site-directed mutagenesis employing the QuikChange XL mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) and respective DNA oligonucleotides (Sigma-Aldrich Sweden AB, Stockholm, Sweden). Introducing the following mutations into the cDNA of enhanced GFP resulted in the generation of pB.0spH: M1K, S147D, N149Q, S202F and Q204T.Mouse (prepro)glucagon cDNA was generated by RT-PCR using primers MMGCG1 TGTCTACACCTGTTCGCAGC (upstream primer) and MMGCG2 GTGACTGGCACGAGATGTTG (downstream primer) and RNA of glucagon-producing αTC1-9 cells (American Type Culture Collection, Manassas, VA, USA). The cDNA was subcloned into pCRII (Thermo Fisher Scientific, Waltham, MA, USA) generating pCRII.MMGCG. To generate pENTR.rGlcg.MMGCG, we first subcloned the rGlcg.DsRed2 cassette from pGlcg.DsRed249 into pENTR1A (Thermo Fisher Scientific, Waltham, MA, USA) and then exchanged the DsRed2 sequence by the MMGCG cDNA, thus obtaining pENTR.rGlcg.MMGCG. To construct pENTR.rGlcg.MMGCG(1-104)-spH, we first introduced a Cla1-site in the MMGCG sequence thus introducing mutations SD105,106ID and then cloned in-frame the spH cDNA from pB.0spH. All constructs were verified by DNA sequence analysis.The rGlcg.MMGCG(1-104)-spH-cassette was transferred into the promoterless adenovirus plasmid pAd/PL-DEST (Thermo Fisher Scientific, Waltham, MA, USA) by the Gateway technique. The ViraPower Adenoviral Expression System (Thermo Fisher Scientific, Waltham, MA, USA) was used to generate a replication-deficient adenovirus, which was used for transduction of cells and islets.ImmunofluorescenceVerification of the biosensor by immunofluorescenceIsolated primary rat alpha cells were prepared and transduced as described below. 72 h after start of transductions the cells were fixed with 4% paraformaldehyde for 30 min. They were washed with PBS and incubated with primary antibodies against pro-hormone convertase 2 (PC2, rabbit monoclonal, 1:300, Cell Signalling, Danvers, MA, USA) and GFP (chicken, 1:1000, ABCAM, Cambridge, UK) in the presence of 0.1% Triton-X100 for permeabilisation and 2% BSA for blocking 24 h at room temperature. Cells were washed 3 times with PBS and incubated with a secondary Alexa546-labelled anti-rabbit antibody (1:1000, Thermo Fisher Scientific, Waltham, MA, USA) and a secondary Alexa488-labelled anti-chicken antibody (1:1000, Thermo Fisher Scientific, Waltham, MA, USA) under the same conditions. Imaging was performed using a LEICA SP2 confocal microscope equipped with a 63 × 1.2 NA lens with the following settings: between lines sequential scanning to avoid spectral bleed through, 488/546 double dichroic mirror, Alexa488 excitation at 488 nm, detection at 505–535 nm; Alexa 546 excitation 546 nm, detection 560–620 nm. Image preparation for publication was performed using FIJI50.Immunofluorescence of sorted cellsCells were fixed with 4% paraformaldehyde for 15 min and stained according to a procedure previously described51 using mouse monoclonal anti-glucagon antibody (Sigma-Aldrich Sweden AB, Stockholm, Sweden) and secondary goat anti-mouse IgG–Alexa 647 polyclonal antibody (Invitrogen, Stockholm, Sweden). Cells were covered with Vectashield mounting medium containing 1.5 µg/ml 4′,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Immunkemi F&D AB, Järfalla, Sweden) and examined with a BD Pathway 855 High-Content Bioimager (BD Biosciences, Rockville, MD, USA) with an Olympus UPlanSApo 10×/0.40 objective. Segmentation of cells based on nucleic DAPI fluorescence staining and subsequent immunofluorescence intensity analysis was performed with the BD Attovision software. Classification and counting of cells was done with the FlowJo Software (Tree Star Inc., Ashland, OR, USA).Analysis of glucagon secretion by TIRF microscopyCells were maintained in complete Improved MEM Zn2+ Option (Richter’s Modification) medium, supplemented with 10% fetal bovine serum, 100 units/ml penicillin G, 100 μg/ml streptomycin sulphate and 10 mM HEPES pH 7.4. Sorted alpha cells were seeded onto 25 mm glass coverslips and transduced 24 h later with the biosensor by incubation with 107 pfu/ml of the adenovirus for 4 h. Transduction was performed 72 h prior to the experiments. For imaging experiments the coverslips were transferred to a perifusion chamber and perifused with a buffer containing 0.1% BSA, 125 mM NaCl, 5.9 mM KCl, 1.28 mM CaCl2, 1.2 mM MgCl2, 25 mM HEPES pH 7.4 and between 1 and 11 mM glucose. TIRF imaging was performed using a ZEISS Axiovert 200 M microscope equipped with a Plan-Fluar × 100/1.45 oil TIRF objective, a TIRF-slider, a LASOS 77 laser for excitation and an AxioCamHS camera for image acquisition. For detection of pHluorin fluorescence the following filter set was used: excitation 488/10 nm, dichroic 492 nm and emission 520/35 nm. Image capture was performed as fast as possible using the camera in 4 × binned mode with an exposure time of 90 ms. Image analysis to identify release events was performed using FIJI50. Release events were identified by analysing fluorescence intensity over time in a grid of 10 × 10 pixel squares that were placed over the analysed cell. A release event was detected as peak of fluorescence intensity. If the peak of fluorescence intensity in one square was at the exact same time point but lower than the peak in one of the eight neighbouring squares, it was considered a spillover from a neighbouring square and not counted as a release event. The number of release events was normalized to the surface area of the analysed cell.Statistical analysis was performed using Excel and Student’s t-test for determination of significance for single comparisons. For multiple comparisons Origin (OriginLab Corporation, Northampton, MA, USA) and ANOVA followed by Scheffé-test for means comparison were used to determine significance levels.Pharmacological manipulation of glucokinase activity in sorted alpha cellsGlucokinase activity was manipulated by acute treatment with either 0.1 µM, 1 µM or 10 µM glucokinase activator RO0281675 (Roche) or with 10 mM of the glycolysis inhibitors 5-Thio-d-glucose, 2-Deoxy-d-glucose or d-Mannoheptulose (Sigma-Aldrich Sweden AB, Stockholm, Sweden). The inhibitors were added to medium containing 4 mM glucose, each incubation lasted for 4 min, with a 4 min washout between inhibitor treatment and 3 mM glucose. The glucokinase activator was used at 3 mM and 4 mM glucose. The cells were incubated in either 4 mM glucose or 3 mM glucose sequentially without (untreated) or rising concentrations (0.1 µM, 1 µM or 10 µM) of the glucokinase activator RO0281675.Manipulation of glucokinase expression in sorted alpha cells by siRNA mediated glucokinase knockdownsiRNA against rat glucokinase (SI01515878, performance of which was tested in INS-1 cells) and validated non-targeting negative control siRNA (SI1027310) were purchased from QIAGEN (QIAGEN, Hilden, Germany). The sorted cells were transfected first overnight with the siRNA using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) and 48 h after start of transfection the cells were transduced with the biosensor for 4 h. All experiments were performed 5 days after start of transfection with the siRNA. After the imaging experiment, cells were lysed and knockdown of glucokinase was confirmed by RT-PCR by using glucokinase and Cyclophilin A TaqMan assays (Rn00561265_m1 and Rn00690933_m1) without pre-amplification. Knockdown to 23.5 ± 3.5% (mean ± SEM) was achieved (n = 3).Analysis of glucokinase transcriptsRT-PCR, cloning and analysis of glucokinase transcripts were performed as described in18. Briefly, mRNA was isolated from FACS-sorted alpha cells using the RNeasy Micro kit (Qiagen, Hilden, Germany). cDNA was synthesized using the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). The following primers were used: GK-3 5′-AATCTTGCGGAACACTGAG-3′ upstream of the AUG start codon of the neuroendocrine glucokinase and the antisense primer GK-2 5′-CCACATTCTGCATTTCCTC -3′, binding in exon 718. The resulting PCR-products were subcloned into the pCRII vector using the TA Cloning kit (Thermo Fisher Scientific) according to the manufacturors instructions. In total 76 clones were analysed by restriction enzyme digestion and sequencing.Single cell RT-PCRSingle cell RT-PCR was performed as described in52. Cell types were determined by the detection of insulin-, glucagon-, somatostatin- and pancreatic-polypeptide-mRNA respectively. cDNAs were then pre-amplified using the TaqMan PreAmp Master Mix Kit (Thermo Fisher Scientific, Waltham, MA, USA) and hexokinase I-III and glucokinase (hexokinase IV) expression levels were determined. All expression RNA detection levels were normalized to cyclophilin A (Ppia). The following TaqMan assays were used:
Gene

Assay Nr

Symbol

Insulin

Rn01774648_g1

Ins2

Glucagon

Rn00562293_m1

Gcg

Somatostatin

Rn00561967_m1

Sst

Pancreatic polypeptide

Rn00561768_m1

Ppy

Ghrelin

Rn00572319_m1

Ghr1

Glucokinase

Rn00561265_m1

Gck

Hexokinase 1

Rn00562436_m1

HK1

Hexokinase 2

Rn00562457_m1

HK2

Hexokinase 3

Rn01448747_m1

HK3

Cyclophilin A

Rn00690933_m1

Ppia

Via Source link