An autophagy enhancer ameliorates diabetes of human IAPP -transgenic mice through clearance of amyloidogenic oligomer

An autophagy enhancer ameliorates diabetes of human IAPP -transgenic mice through clearance of amyloidogenic oligomer

AnimalshIAPP+ mice expressing hIAPP under the control of the rat insulin II promoter (FVB/N-Tg (Ins2-IAPP) RHFSoel/J mice, Stock No. 008232, Jackson Laboratory) were maintained on an FVB/N background, and genotyping was conducted by PCR analysis of tail DNA using specific primers (forward, 5’-GTCATGTGCACCTAAAGGGGCAAGTAATTCA-3’; reverse, 5’-CGAGTGGGCTATGGGTTTGT-3’)3. TfebF/F mice were generated by breeding Tfebtm1a(EUCOMM)Wtsi mice (Mutant Mouse Resource and Research Center, MMRRC) with FLPeR mice (Wellcome Trust Sanger Institute). hIAPP+ mice with targeted disruption of Tfeb in pancreatic β-cells were generated by crossing RIP-Cre mice (Jackson Laboratory) with TfebF/F mice and then with hIAPP+ mice (hIAPP+TfebΔβ-cell mice). GTT was conducted by the intraperitoneal injection of 1 g/kg glucose to overnight fasted mice. Blood glucose concentration was measured using a One Touch glucometer (Lifescan) at 0, 15, 30, 60, 120, and 180 min after glucose injection3. ITT was performed by intraperitoneal injection of 1 U/kg regular insulin to fasted mice and measuring blood glucose levels at 0, 15, 30, 60, 120, and 180 min after insulin injection33. Serum insulin levels before and 15 min after the glucose challenge were measured using an ELISA kit (Shibayagi Co.) to calculate insulinogenic index (∆insulin15min/∆glucose15min)3.Cynomolgus monkeys purchased from Guangxi Grandforest Scientific Primate Company Ltd. were maintained in the Orientbio Animal Facility3.All animals were maintained in a specific pathogen free (SPF) facility accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC). All animal experiments were approved by the Institutional Animal Care and Use Committee of Yonsei University Health System (IACUC of YUHS) and were conducted in accordance with the Public Health Service Policy on Humane Care and Use of Laboratory Animals. Monkey experiments were approved by the IACUC of Orientbio, another AAALAC-accredited unit.MSL-7 was dissolved in DMSO to make 125 mg/ml stock solution, and diluted with PBS to 5 mg/ml for injection (50 mg/kg, intraperitoneally 3 times a week for 8 weeks). To study MSL-7 effect on STZ-induced hIAPP oligomer accumulation, STZ (Sigma) dissolved in 0.1 M citrate buffer, pH 4.5, was injected into mice intraperitoneally to 2-month-old male hIAPP+ mice at a dose of 80 mg/kg. Twenty-four h later, MSL-7 administration was started and continued every other day for a total of 3 times.Isolation of pancreatic isletsPrimary monkey islet cells were isolated using the modified Ricordi’s method34 as previously described3. In brief, the pancreas dissected from a 60-month-old male monkey was placed in 4 °C HTK solution for distention with 3–4 ml/g pancreas cold Liberase MTF C/T solution (Roche Custom Biotech). The distended pancreas was placed in an isolation chamber equipped with a peristaltic pump, and the temperature was raised to 37 °C. The isolation chamber was gently shaken during digestion, and serial samples were examined under a light microscope after dithizone (Sigma Aldrich) staining. When liberated pancreatic islets were observed, Dilution Solution (Corning) was added to inactivate Liberase MTF C/T. Digested cells collected into 200 ml conical tubes were washed with Washing Solution (Corning). Islets were then isolated by continuous density gradient centrifugation using a COBE 2991 Cell Processor (Terumo BCT Inc.) in iodixanol density gradient media (OptiprepTM Axis-Shield, Alere Technologies AS) for culture in CMRL1066-10% FCS at 37 °C.Primary murine islets were isolated from fasted mice using the collagenase digestion technique as previously described35. In brief, after injection of 2.5 ml of collagenase P (0.8 mg/ml) into the common bile duct, the pancreas was procured and incubated in a collagenase solution at 37 °C for 13 min 20 s. After cessation of enzymatic digestion with cold HBSS-5% FCS, tissue was passed through a 400 μm sieve and then centrifuged on 1.10, 1.085, 1.069 and 1.037 g/ml Biocoll gradients (Biochrom). Islets were collected from the interface using micropipettes.CellsINS-1 cells (kindly provided by Dr. C. Wollheim, University of Geneva) were cultured in RPMI-1640 supplemented with 10% FCS, 1 mM sodium pyruvate (Sigma-Aldrich), 10 mM HEPES (Corning), 50 μM 2-mercaptoethanol (Sigma-Aldrich) and 100 U/ml penicillin-100 μg/ml streptomycin (Lonza) (passage number, 89). 1.1B4 cells were obtained from ECACC (Salisbury) through Fadzilah Adibah Abdul Majid (Universiti MalaysiaTerengganu), and cultured in RPMI 1640-10%FCS-100 U/ml penicillin-100 μg/ml streptomycin (passage number, 35). MSL-7 was dissolved in DMSO to obtain 20 mM stock solution and directly diluted to the final concentrations in culture medium for in vitro experiments. All cells were free of mycoplasma contamination. All in vitro experiments were repeated at least three times to confirm reproducibility.hiPSC generation and differentiation into insulin-producing cellshiPSCs were derived by umbilical cord blood mononuclear cells, and reprogramming was conducted using CytoTune-iPS Sendai Reprogramming Kit (Life Technologies). Healthy human cord blood had been obtained from newborn after obtaining informed parental consent at Catholic Hematopoietic Stem Cell Bank of Korea. hiPSCs were adapted to feeder-free conditions on vitronectin (VTN-N) (Gibco)-coated plates in TeSRTM-E8TM medium (STEMCELL Technologies). These cells were incubated at 37 °C in a 5% CO2 atmosphere, and the medium was changed daily. To initiate differentiation, confluent hiPSCs were dissociated into single cell suspension using TrypLE and seeded at 1.0 × 106 cells per well in AggrewellTM 400 plates (STEMCELL Technologies) for incubation in AggreWellTM medium with 10 μM Rho kinase inhibitor (Y-27632). After 24 h of incubation, aggregated cells were differentiated into insulin-producing cells using STEMdiffTM Pancreatic Progenitor Kit (STEMCELL Technologies). At the stage for pancreatic progenitor generation, 0.25 μM SANT1 (Sigma-Aldrich) was added for the last 2 days. Cells were then cultured in CMRL medium (Welgene) containing 25 ng/ml human HGF (PeproTech), 10 mM nicotinamide (Sigma-Aldrich), 20 ng/ml Exendin-4 (ProSpec), 1 μM T3 (Sigma-Aldrich) and 10 μM Alk5 inhibitor (Biogems) for 6 days to produce insulin-producing cells. For immunofluorescence or TUNEL staining of iPSC-β-cells, islet-like clusters were pre-embedded in agar before paraffin embedding. All experiments using hiPSC were conducted in accordance with the protocol approved by the IRB of the Catholic University of Korea.TUNEL staining and β-cell massDeparaffinized pancreatic sections were incubated with TUNEL reagent (Roche Applied Science) and DAB (Life Technologies) as the color substrate. Insulin immunochemistry was then conducted by serial incubation with anti-insulin antibody (Cell Signaling Technology, 1:150), biotinylated anti-rabbit antibody (Vector Laboratories, 1:100), streptavidin-alkaline phosphatase, and then with Vector® Blue alkaline phosphatase substrate3 (Vector Laboratories). The percentage of TUNEL+ cells among total β-cells was determined in more than 30 islets per mouse (more than 180 islets per group) by manual counting under BX43 microscope (Olympus). To detect TUNEL+ cells among hiPSC-β-cells, TUNEL staining was followed by incubation with anti-insulin antibody and then with Alexa 594-anti-mouse IgG (Life Technologies, 1:200) which was subjected to fluorescent confocal microscopy using LSM700 microscope (Carl Zeiss). The percentage of TUNEL+ cells among insulin+ cells was determined in more than 20 islet-like clusters by manual counting. Relative β-cell mass was determined by analyzing more than 30 islets per mouse (more than 180 islets per group). After insulin immunohistochemistry using anti-insulin antibody and DAB, point counting morphometry was conducted as previously described3.IAPP expression in vitroThe transient transfection of prepro-hIAPP-HA and prepro-mIAPP-HA3 was conducted using jetPEI® DNA transfection reagent (Polyplus Transfection)3. To block autophagy of transfected cells, after 24 h of transfection, the culture medium was changed to a new medium containing 5 mM 3-MA (Sigma Aldrich) or 10 nM bafilomycin A1 (Sigma Aldrich). After another 16 h of incubation with or without MSL-7, cells were subjected to electrophoretic separation after lysis, immunofluorescence or oligonucleosome detection by ELISA3.Generation of CRISPR/Cas9 KO cellsTo make Tfeb-KO or Tfe3-KO INS-1 cells, cells were transfected with 2 μg each of sgRNA plasmid (Tfeb sgRNA1, CATGCAGCTCATGCGGGAGCAGG; Tfeb sgRNA2, TGAACTGGGGTGTTGATGGCTGG; Tfe3 sgRNA1, TGCTGCGGCAGCAGCTTATGAGG; Tfe3 sgRNA2, GGGGTGGACGACTCAATGTGTGG), and Cas9-Puro2A-RFP using jetPEI® DNA transfection reagent (Polyplus Transfection). After puromycin selection, genomic DNA was isolated, followed by two rounds of PCR using specific primers (Tfeb 1st-F, AGGGCAGGAACAGGATGATG; Tfeb 1st-R, CCAGCAGAGTTGCAAGACGA; Tfeb 2nd-F, GATGTGGATGTGACAGCGAG; Tfeb 2nd-R, GACTGTTGGGGGCACTGTTG; Tfe3 1st-F, GCTCCAGCGTAGGTTTAGCA; Tfe3 1st-R, CACGAGGACCCTGAGTGATG; Tfe3 2nd-F, TAGCTTACCTGTGGCCCTGT; Tfe3 2nd-R, GGACCCTGAGTGATGATTCCT) and a T7E1 cleavage assay using a kit (New England Biolabs). Cells with mismatched mutations were isolated by the low-density seeding method. Gene KO was confirmed by nucleotide sequencing using an automatic DNA analyzer (Bioneer).Confocal microscopyImmunofluorescence of MiTF/TFE family members in INS-1 cells, 1.1B4 cells or primary pancreatic islet cells was conducted using anti-TFEB (Bethyl Laboratories, 1:150), anti-TFE3 (Sigma Aldrich, 1:150), or anti-MiTF (Thermo Fisher Scientific, 1:150) as the primary antibodies. For TFEB immunostaining of INS-1, 1.1B4 or primary islet cells, cells with nuclear TFEB were considered to be activated even though residual cytosolic TFEB is detected because TFEB staining was observed only in the cytoplasm and nuclear TFEB was almost completely absent in most of untreated cells, while nuclear TFEB staining with residual cytosolic TFEB staining was seen after treatment with MSL-7. For TFE3 immunostaining, cells with bright nuclear TFE3 without cytosolic TFE3 were considered to be activated because faint nuclear TFE3 was observed in untreated cells, while bright nuclear TFE3 staining without cytosolic TFE3 staining was observed in most cells after MSL-7 treatment. The percentage of cells with nuclear TFEB or TFE3 among total DAPI+ cells was determined by counting more than 100 cells from more than 5 fields manually.hIAPP oligomer in frozen tissue sections or in cells cultured in a Lab-Tak® II Chamber Slide (Thermo Fisher Scientific) was identified by immunostaining using A11 antibody (Merck Millipore, 1:150) and Alexa 488-anti-rabbit IgG (Life Technologies, 1:200). To analyze IAPP oligomer accumulation in cultured cells, confocal microscopy was conducted using LSM700 microscope, and the numbers of A11+ puncta in more than 20 cells were counted manually. To study hIAPP oligomer accumulation in the pancreas, the percentage of A11+ cells among total DAPI+ islet cells in pancreatic sections was determined by manually counting more than 20 islets per mouse (more than 132 islets per group). To investigate colocalization of A11 puncta with autophagosome, immunostaining using A11 antibody was followed by immunostaining using anti-LC3 antibody (MBL, 1:150) and then with Alexa 594-anti-mouse IgG (Life Technologies, 1:200). Confocal microscopy was conducted using LSM700 microscope, and the number of yellow puncta (autophagosome colocalized with A11) was counted manually in more than 20 cells.Amyloid stainingFSB staining for tissue amyloid was conducted using a modification of previously reported methods36,37. Briefly, pancreatic sections were deparaffinized in xylene and hydrated down to 30% ethanol. Deparaffinized sections were incubated in 70% formic acid for 20 min. After incubation with 10 μM FSB (Merck Millipore) for 1 h at room temperature with light protection, sections were subjected to fluorescent microscopy using BX53F fluorescent microscope (Olympus). Mean pixel intensity per islet area was determined in more than 25 islets per mouse (more than 151 islets per group) using ImageJ software (NIH).Transfection and plasmidsCells were transiently transfected with plasmids such as Tfeb-GFP or Tfe3-GFP using jetPEI® DNA transfection reagent. Nuclear translocation of Tfeb-GFP or Tfe3-GFP was determined after treatment of transfected INS-1, 1.1B4 or primary monkey islet cells with MSL-7 for 4 h by confocal microscopy. To examine autophagosomes and autophagolysosomes, tandem mRFP-GFP-LC3 was transfected using lipofectamine 2000 (Life Technologies). Confocal microscopy was conducted after treatment of transfected cells with MSL-7 for 4 h using LSM700 microscope. GFP or RFP puncta were defined as non-nuclear punctate structures with discrete fluorescent signal on a dark background which was clearly visible with fluorescent confocal microscopy. The numbers of yellow puncta (autophagosomes) and red puncta (autophagolysosomes) in more than 20 cells were counted manually.Immunoblot analysis and antibodiesCells were lysed with a buffer (1% SDS, 100 mM Tris, pH 7.5, 0.5% Triton X-100) containing protease and phosphatase inhibitors. Protein concentration was determined using the Bradford method. Samples (5–10 μg) were separated on 4–12% Bis-Tris gel (NuPAGE®, Life Technologies), and transferred to nitrocellulose membranes (Merk Millipore) for immunoblot analysis using the enhanced chemiluminescence (ECL) method (Dongin LS). Antibodies against the following proteins were used: SQSTM1 (Progen Biotechnik, 1:5000), LC3 (Novus Biologicals, 1:1000), TFEB (Bethyl Laboratories, 1:1000), TFE3 (Sigma Aldrich, 1:1000), phospho-S142-TFEB (Merk Millipore, 1:1000), phospho-(Ser) 14-3-3 binding motif (Cell Signaling Technology, 1:1000), 14-3-3 protein (Cell Signaling Technology, 1:1000), β-actin (ACTB) (Santa Cruz Biotechnology, 1:4000), HA (Cell Signaling Technology, 1:1000) or Lamin A (Santa Cruz Biotechnology, 1:1000). Densitometry of the protein bands was performed using ImageJ.ImmunoprecipitationAfter lysis of Tfeb-GFP or Tfe3-GFP transfectant or nontransfectant INS-1 cells treated with MSL-7 for 4 h in ice-cold lysis buffer (400 mM NaCl, 25 mM Tris–HCl, pH 7.4, 1 mM EDTA, and 1% Triton X-100) containing protease and phosphatase inhibitors, lysates were centrifuged at 13,000 × g for 10 min in a microfuge tube and incubated with anti-GFP (1:1000, AbFrontier), anti-TFEB (Bethyl Laboratories, 1:1000) or anti-TFE3 antibody (Sigma Aldrich, 1:1000) in binding buffer (200 mM NaCl, 25 mM Tris–HCl, pH 7.4, 1 mM EDTA) with constant rotation at 4 °C for 1 h. After adding 50 μl of 50% of Protein-G beads (Roche Applied Science) slurry to the lysates and incubation with rotation at 4 °C overnight, resins were washed with binding buffer. After resuspension of the pellet in a Sample buffer (Life Technologies) and heating at 100 °C for 3 min, the supernatant was collected by centrifugation at 13,000 × g for 20 s for electrophoretic separation in a NuPAGE® gradient gel (Life Technologies). Immunoblotting was conducted using primary antibody (anti-phospho-(Ser) 14-3-3 binding motif antibody (1:1000) or anti-pan 14-3-3 antibody (1:1000) from Cell Signaling Technology), horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (Cell Signaling Technology), and then, an ECL kit for detection of chemiluminescence.Cell fractionationAfter washing cells with chilled PBS (all subsequent steps, on ice), 200 μl of a lysis buffer (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.05% Igepal containing protease and phosphatase inhibitors) was added to each well of a 6-well plate. After scraping cells and douncing, the extract was centrifuged at 845 × g for 10 min. Nuclear fraction was resuspended in a buffer containing 5 mM HEPES, pH 7.9, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 26% glycerol (v/v) and 300 mM NaCl. Both nuclear and cytoplasmic fractions were resuspended in a sample buffer (Life Technologies) for immunoblot analysis.RNA extraction and real-time RT-PCRcDNA was synthesized using total RNA extracted from cells with TRIzol (Life Technologies) and M-MLV Reverse Transcriptase (Promega) according to the manufacturer’s protocol. Real-time RT-PCR was performed using AccuPower® GreenStarTM qPCR master mix (Bioneer) in a QuantStudio3 Real-Time PCR System (Applied Biosystems). All expression values were normalized to Rpl32 mRNA level. The sequences of primers used for real-time RT-PCR are listed in the Supplementary Tables 1 and 2. Expression of MiTF/TFE family genes in primary mouse islets was studied by RT-PCR using specific primers (Tfeb F, GGTCTTGGGCAAATCCCTTC; Tfeb R, CATGGCAGCTGTTGGTTCG; Tfe3 F, CCGTGTTCCTGCTATTGGAA; Tfe3 R, CGTAGAAGCTGTCAGGATCG; Mitf F, GAAGTCGGGGAGGAGTTTCA; Mitf R, GCCACTCTCTGTTGCATGA).Islet cell deathPrimary monkey islets or 1.1B4 cells were placed on a Cell Culture Plate (SPL Life Sciences), and incubated with MSL-7 in the presence or absence of 5 mM 3-MA for 16 h. Apoptosis was quantified by measuring the amount of oligonucleosomes in cell lysate by ELISA employing a kit (Roche Applied Science), according to the manufacturer’s instruction. Apoptosis of wild-type INS-1 cells, Tfeb-KO or Tfe3-KO INS-1 cells after transfection of prepro-IAPP-HA was determined using the same method of oligonucleosome detection.Pancreatic insulin contentPancreatic insulin was extracted and insulin content was measured by ELISA according to the protocol recommended by the manufacturer, and normalized to the total pancreas38.O2 consumption of isletsO2 consumption of isolated mouse islets was measured using Seahorse Extracellular Flux (XFe96) Analyzer (Agilent Technologies) according to a modification of the manufacturer’s protocol. In brief, islets were seeded into wells of a poly-L-lysine-coated XF96 spheroid microplate (25 islets/well). Islet seeding was done by inserting pipette tip directly over the central depressed chamber into the wells of the spheroid microplate. Islets then were incubated with pre-warmed XF assay medium (Seahorse XF base DMEM medium supplemented with 3 mM glucose, 1% fetal bovine serum, 1 mM sodium pyruvate and 2 mM glutamine) for 1–2 h at 37 °C in a non-CO2 incubator. Mitochondrial respiration was measured using the Seahorse extracellular flux analyzer equipped with a spheroid microplate-compatible thermal tray. Basal respiration was first measured in XF assay medium containing 3 mM glucose. Islets were then sequentially exposed to 20 mM glucose, 5 μM oligomycin, 1 μM carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP) and 5 μM rotenone in combination with 5 μM antimycin A (Rot/AA) at the indicated time points to measure glucose-stimulated, ATP-coupled, maximal and non-mitochondrial O2 consumption, respectively. O2 consumption was analyzed using a software (WaveTM, Agilent Technologies).Statistical analysisAll values are expressed as the means ± SEM of more than 2 independent experiments. Two-tailed Student’s t-test was used to compare values between two groups. One-way ANOVA with Tukey’s test or two-way ANOVA with Bonferroni’s test was employed to compare values between multiple groups. P values < 0.05 were considered significant.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article.

Via Source link